Procedure

The mutagenesis procedure essentially comprises four steps:

Step 1: Intron design

The target-specific changes needed to be made to the ClosTron RNA-encoding region are determined using the Perutka method [2]. The intron design tool can be used to find optimal targeting sites for a given query.

Step 2: Plasmid Construction

There are two ways to easily retarget a ClosTron Vector to a new custom target. You can source the base ClosTron plasmid from www.plasmidvectors.com, which contains a placeholder lacZ fragment between the HindIII and BsrGI sites. If this is your first time retargeting the ClosTron vector, you will need to follow Option 1 and synthesize the custom targeting region. If you already have a vector with an existing targeting region, you can either follow Option 1 or Option 2.

Order custom ClosTron vectors and mutant strains

Option 1: DNA Synthesis of Custom Retargeting Regions

The custom retargeting regions can be synthesized de novo as a double-stranded DNA fragment and then incorporated into the base ClosTron vector either through restriction digest and ligation-based methods or PCR-based assembly methods such as Gibson Assembly or NEBuilder® HiFi DNA Assembly.

For restriction-ligation-based methods, the 309 bp custom region output by the design tool may be flanked with additional sequence from the base ClosTron vector to allow digestion with HindIII and BsrGI. The sequence for synthesis could be designed as follows (HindIII and BsrGI sites are underlined):

    TTTTAAGCTTATAA - 309bp targeting region - TATCTGTTATCACCACATTTGTACAATCT
    (Total: 352 bp fragment size)

For PCR-based assembly methods, additional flanking sequence may be included to enable overlapping oligonucleotide binding regions. An example sequence (potential binding regions underlined) is:

    CGTATAAAGTTGTGTAATTTTTAAGCTTATAA - 309bp targeting region - 
    TATCTGTTATCACCACATTTGTACAATCTGTAGGAGAACCTATG
    (Total: 385 bp fragment size)

Once your retargeting vectors have been assembled and sequence-verified, you are ready to proceed with the next steps in your target organism.

Option 2: Inclusion of Target-Specific Changes within DNA Oligonucleotide Primers

Alternatively, the required changes to the targeting regions can be introduced via PCR amplification using custom primers from a vector containing an existing targeting region. These primers are automatically generated by the Intron Design Tool and can be incorporated into a ClosTron vector as described in the initial ClosTron paper.

This process involves a two-step PCR using two sets of partially overlapping primers, requiring three bespoke primers and one universal primer. Using an existing targeting region as a template:

The gel-purified 352 bp PCR amplicon can then be cloned into the ClosTron plasmid backbone via HindIII / BsrGI sites included in the primers or by PCR-based assembly methods such as Gibson Assembly or NEBuilder® HiFi DNA Assembly.

Primer Sequences:
    IBS Primer: 5’ - AAAAAGCTTATAATTATCCTTANNNNNNNNNNNNGTGCGCCCAGATAGGGTG
    EBS Universal Primer: 5’ - CGAAATTAGAAACTTGCGTTCAGTAAAC
    EBS2 Primer: 5’ - TGAACGCAAGTTTCTAATTTCGNTTNNNNNTCGATAGAGGAAAGTGTCT
    EBS1d Primer: 5’ - CAGATTGTACAAATGTGGTGATAACAGATAAGTCNNNNNNNNNAACTTACCTTTCTTTGT

Underlined nucleotides represent the modified regions. Bold nucleotides indicate the HindIII (IBS Primer) and BsrGI (EBS1d Primer) recognition sites for cloning into the vector backbone.

Step 3: Plasmid Transfer

Following construction of your plasmid(s), introduce into your target organism by either conjugative plasmid transfer or transformation selecting for the plasmid marker. This will usually be catP, therefore requiring selection on media containing thiamphenicol.

Step 4: Integrant Isolation

Constitutive expression of the intron means that intron insertion into the host target begins to take place as soon as the ClosTron plasmid enters the cell. To isolate merely re-streak one or more transformants onto agar plates supplemented with erythromycin (or lincamycin) at a concentration appropriate to the strain. To confirm insertion of the intron in the erythromycin or lincamycin resistant colonies PCR screening will be necessary using primers that flank the intended site of insertion. DNA fragments generated should be authenticated by size and correct nucleotide sequence. To confirm single insertion of the intron it will be necessary to either perform a Southern blot or deploy nanopore whole genome sequencing.

If you require help using the tool or understanding this process please contact us.